jadee05
jadee05 jadee05
  • 10-02-2022
  • Mathematics
contestada

Please help asap
I cant figure out the answer

Please help asap I cant figure out the answer class=

Respuesta :

semsee45
semsee45 semsee45
  • 10-02-2022

Answer:

3

Step-by-step explanation:

[tex]x=\sqrt{2x+3}[/tex]

square both sides:   [tex]x^2=2x+3[/tex]

subtract [tex]2x + 3[/tex] from both sides:  [tex]x^2-2x-3=0[/tex]

factorize:  [tex](x-3)(x+1)[/tex]

Therefore, [tex]x=3 \ and \ -1[/tex]

Substitute found values of [tex]x[/tex] back into original equation:

[tex]3=\sqrt{2\times3+3}=3 \ \ \checkmark[/tex]

[tex]-1=\sqrt{2\times-1+3}=1[/tex]  incorrect!

So answer is [tex]x = 3[/tex] only

Answer Link

Otras preguntas

A triangle has sides of length 10 m, 15 m, and 8m. Is it a right triangle?
Which statement best explains the process occurring in step 4 of the lifecycle?​
How do I use a codon wheel to solve this sequence of DNA? AGTACCCGTTAATTAGTTGCCG
When did space race begin
Which ideas in this paragraph support the idea that it is important to achieve one’s dreams and help others achieve theirs? Check all that apply. Pausch played
Como se dice mi amigo en ingles
Which factor helped farmers on the Great Plains overcome opposition from cattle ranchers? The farmers allied with Native American Indians. Ranchers refused to d
y=4x−2 y=x+3 what are the values of x and y
Helpp i will mark if right
The Southern states were unhappy with Reconstruction. They saw it as punishment by the . They were also against , as shown by the Black Codes.