Iwritewithpencils Iwritewithpencils

14-05-2020
Biology

contestada

How do I use a codon wheel to solve this sequence of DNA?

AGTACCCGTTAATTAGTTGCCG

Respuesta :

andyk38105 andyk38105

14-05-2020

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

Answer Link

Otras preguntas

Which of the following locations was the first place Jim Crow laws were instituted? Public restrooms Resturants Public Parks Railroad passenger transportation

why did the united states and the soviet union become enemies after world war 2

Spanish explorers wanted _______ a)great art b)natural wonders c)Scientific specimens d)gold silver

Solve: 110°20' PLS TRY to translate degrees and minutes to degrees! BRAINLIEST for 1st answer :)

WILL GIVE BRAINLIEST Explain the arrangement which king Phillip II tried to make with Elizabeth I.

You buy a quart of ice cream that comes in a cylindrical tub. A quart has a volume of about 58 cubic inches. The tub has a height of 5 inches. What is the radiu

For all values of x, which expression is equivalent to 9(2x+9)+2(2x+9)

What is the the Impact and Significance of the great wall of china?

Fill in the missing words to correctly complete each sentence pertaining to job acquisition skills. If you know the company that you want to work for, you shoul

What is the purpose of the pancreas? a.mixing blood and oxygen b.removing excess fluids from the body c.storing large quantities of blood, minerals, and vitamin