epicmincraft123 epicmincraft123

09-12-2020
Mathematics

contestada

Help me please thank you I appreciate it

Help me please thank you I appreciate it class=

Respuesta :

ronniemath ronniemath

09-12-2020

Angle xyz
Angle zyx
Acute angle.

Answer Link

Otras preguntas

Why did Bolivia name it’s country after Bolivar? A- He conquered the area. B- He bought the area. C- He liberated the area. D- He was the primary ruler.

Substance users are often found in the jail and prison systems. Select one: True False

Assume that y varies directly with x, then solve. If y=6 when x=2/3, find x when y=12.

s varies directly as t, and = 8 when = 16. Find the constant of variation and write a direct variation equation relating s and t. Then find t when = 16. (Wri

Who joined the Axis powers?

6th grade math... anybody can help ?! :)

How do I use a codon wheel to solve this sequence of DNA? AGTACCCGTTAATTAGTTGCCG

What does JIT delivery require?A. More skillful manufacturersB. International tradeC. Bigger storesD. Computer inventory systems

What happened in the banking industry in the years leading up to 1933? Bank failures were_____. staying about the same declining increasing

Write 1.02 in fraction form