itsnaisa0692 itsnaisa0692

11-05-2022
History

contestada

In approximately which year did the United States have the most nuclear weapons ?

Respuesta :

slaemmle25 slaemmle25

11-05-2022

the stockpile peaked in 1967

Answer Link

Otras preguntas

The center of a circle is at the origin. An endpoint of a diameter of the circle is at (-3, -4). How long is the diameter of the circle? 5, 10, or 25?

1.00L of a gas at STP is compressed to 473 ml. What is the new pressure of the gas?

(WILL GIVE 5 STARS AND A THANKS FOR THE RIGHT ANSWER) Compare and contrast major depression with dysthymia depression.

The ability to roll your tongue is inherited genetically from parents if either parent has the dominant trait T. Children of two parents without the trait will

write a introduction about schools should teach students how to managed money and how to do taxes.

In Martinique, there are so many bananas that: A. there is no longer place to grow other crops. B. people's skin has a light yellow tinge. C. there is an

Lithium hydroxide reacts with hydrobromic acid to produce lithium bromide and water. If 10.0 g of lithium hydroxide reacts, how many grams of lithium bromide w

2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the mRNA of the

Why is Alonso feeling depressed and sad?

The area of a rectangular swimming pool is 10x2 – 19x – 15. The length of the pool is 5x + 3. What is the width of the pool?