rasailiannpurana
rasailiannpurana rasailiannpurana
  • 10-07-2021
  • Physics
contestada

what is the equation of preassure


​

Respuesta :

Sidvc
Sidvc Sidvc
  • 10-07-2021
If u mean pressure, pressure = Force/Area
Correct me if I am wrong :D
Answer Link

Otras preguntas

Two populations of a species of frog live around the Gulf of California. One population has a brown back, and lives on rocky islands with brown rocks and little
Neurons contain _________, which can receive signals from other neurons. axons mitochondria dendrites Golgi bodies
Find the measure of angle A. Show equations and all work that leads to your answer.
A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is
The rhynchocoel is a ________. circulatory system fluid-filled cavity primitive excretory system proboscis
The sister taxon of the Chordata is the _____. Mollusca Arthropoda Ambulacraria Rotifera
A cruise ship needs to book at least 2,052 passengers to be profitable, but the most passengers the ship can accommodate is 2,462. Model the numbers of passenge
When 8.2 grams of LiBr are dissolved in enough water to create a 150-gram solution, what is the solution's concentration, expressed as a percent by mass?
How can you identify an author’s claim?
What is the basic difference in effector function between helper and cytotoxic T cells?