ingihuhlwane
ingihuhlwane
07-07-2021
English
contestada
Metaphors or similes for naivety o
Respuesta :
masonxx302
masonxx302
07-07-2021
bro as naive as a 30 year old man that still believes he’ll become a professional basketball player
Answer Link
VER TODAS LAS RESPUESTAS ( 14+ )
Otras preguntas
Use the following DNA sequence to answer these questions.Make sure to explain/justify your answers. This piece of DNA is 29 bases long. 5' GACCGATCGGCTAAGCATCAC
Early payment discount amounts offered by vendors are __________________ if payment is made within the discount period.A. automatically calculated by QBO B. dis
Choose all that may be caused by acidosis. a) Hypercalcemia b) Hyperchloremia c) Hyperkalemia d) Hypochloremia e) Hypokalemia f) Hypocalcemia
Display a countdown on the OLED next, combine the components from parts 1 and 2 with the timer task from lab F and lab C. a) True b) False
There are ____ positive integers less than 100 divisible by 8
Which of the following is the largest category of fragrance? a. floral b. oriental c. spice blend d. floral bouquet.
How does nothing gold can stay form affect its contenthow does the poem nothing gold can stay form effect in its content
A developing nation is more likely to have _____ shape of population pyramid: a) Pyramid b) Urn c) Bell d) Circular
Network Systems, Incorporated, had net sales of $750,000, cost of goods sold of $562,500, and net income of $100,000. Its gross margin ratio is closest to: A. 4
When Oedipus tells Teiresias that he, Oedipus, solved the riddle of the Sphinx, but Teiresias being a prophet could not, how does this support Oedipus’s argumen
