Braguerrerosanchez Braguerrerosanchez
  • 09-06-2021
  • Mathematics
contestada

Which solution finds the value of x in the triangle below?

Which solution finds the value of x in the triangle below class=

Respuesta :

michael96042 michael96042
  • 09-06-2021

Answer: B

Step-by-step explanation:

Answer Link
misael2396
misael2396 misael2396
  • 09-06-2021
The answer would be B.
Answer Link

Otras preguntas

Complete the equation of the line through (-10,3)(−10,3)left parenthesis, minus, 10, comma, 3, right parenthesis and (-8,-8)(−8,−8)left parenthesis, minus, 8, c
Transcribe the following Strand of DNA: GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT
1. Who was Alfred Wegener?
Why does adding salt allow ice to freeze milk? A.It increases the freezing point B.Salt is colder than point C.It increases the boiling point D.It decreases th
26. Which audience would require you to use the most formal tone, If you're delivering a rhetorical speech? O a kindergarten class a group of your peers a mob o
sterling plants a tree that is 4 3/4 feet tall. please do step by step!!!
Help please due today!
So just don't get overwhelmed and you'll make it out and you'll be just fine lyrics.
Please help (30 points) Versailles treaty
What check by the House of Representatives formally accuses a Supreme Court justice of “wrongdoing”? A. filibuster B. impeach C. override D. pardon