24nkennedy
24nkennedy 24nkennedy
  • 06-05-2021
  • Social Studies
contestada

why did pepole want slaves?

Respuesta :

makarima
makarima makarima
  • 06-05-2021

Answer:

Because they wanted people to farm and work for them etc.

Explanation:

Answer Link

Otras preguntas

What is the complementary DNA strand for the following sequence: ATGGCTTGCCAAGGTCCGGAAACTTTG
What number is represented by these base ten blocks
How could you distinguish between traveling west at 5 miles per hour and traveling east at 5 miles per hour without using the words "east" and "west"?
Yan has already finished 3/5 of the 45 math problems he was assigned today. Each math problem took him 1 4/5 of a minute to complete. If this pace continues, ho
Jessie is going river rafting with 10 friends. It costs $10 per person to ride on the rafts. There is also a $6 fee per raft for rental . each raft fits 6 peopl
Find the total number of unit cubes that fill the entire prism
k(t)=13t−2 k(3)=k(3)
What is the answer ?
if the statement “ if the sun is shining then it’s not raining “ is assumed to be true is it’s reverse “ if it’s not raining then the sun must be shining “ also
This invention made amputation much safer, which cut down on the number of people who died during the procedure