RamenDonkey RamenDonkey

14-04-2021
Biology

contestada

what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT?

Respuesta :

officialscripture officialscripture

14-04-2021

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

Answer Link

Otras preguntas

There are 4 boys and they equally share 3 granola bars. How much does each boy gets?

Roger Sherman helped construct the ???

Lorenzo rides his bike at a rate of 5yards per second. about how many miles per hour can he ride his bike?

5 1/8+5/6+5/12=6.375 what is 6.375 as a fraction? A 6 3/4. B.6 3/8. C6 3/12. D 6 3/24 please help

If I put $300 in an account that earns 5.5%, how much will there be in the account at the end of 21 years?

Which statement best describes the tones of "To My Dear Loving Husband" and "To the King's Most Excellent Majesty"? A.)Bradstreet's poem has a thoughtful tone,

do china and Egypt have 4 seasons

which best characterizes the rainfall pattern in india?

What does 1 significant figure mean?

Use the associative law of multiplication to write an equivalent expression. 9[m(6+n)]