redandthemoose89 redandthemoose89

09-04-2021
Mathematics

contestada

2y -x=-4
Y-3=3x

Substitution to solve a problem

Respuesta :

sircrosarman sircrosarman

09-04-2021

Answer:

y=3x+3

heart if it helped :3 brain if im cool <3

Answer Link

lilybyram2 lilybyram2

09-04-2021

Hope this helppppppssss

Ver imagen lilybyram2

Answer Link

Otras preguntas

Isla saw a commercial for a weight loss product that claimed to make consumers lose 50 pounds or more in the first month of use. She believes this is a dangerou

Of the DNA sequences below, which would probably be the harder to determine? a) CGATATATATATATACGATGGCATCACGAGCTGCATTCGCA b) CGATATATATATATACGATGGCATCACGAGCTGCA

Marissa researched the cost to have custom T-shirts printed by several local and online vendors. She found that each store’s charge for the job could be modeled

they themselves elected their president what type of pronoun the underline words option indefinite pronoun option be directly pronoun option C reflexive pronoun

if 500 g of water absorbs 2000 calories of heat during an experiment, what is the temperature change experienced by the water

Fill in the name and empirical formula of each ionic compound that could be formed from the ions in this table:

What is the probability of spinning green and rolling a six? Write your answer as a fraction or a whole number. With fractions, use a slash ( / ) to separate

Answer questions using table. 1.) What is the probability that a randomly selected person is either a Culinary Arts major or an ITS major? 2.) What is the pr

A community youth group is having a raffle to raise funds. Several community businesses have donated prizes. The prizes and their retail value are listed in the

Indicate in which fairy tale characters did the following things. Then complete the sentences selecting the appropriate phrase from the word bank and conjugatin