zjgitzef3m zjgitzef3m
  • 08-03-2021
  • Mathematics
contestada

please help!! thank u

please help thank u class=

Respuesta :

swangxinyi20092009
swangxinyi20092009 swangxinyi20092009
  • 08-03-2021

Answer:

I think it’s #3

Step-by-step explanation:

Answer Link

Otras preguntas

The technique European painters developed of modeling mass in two dimensions through value, which is demonstrated in Da Vinci’s The Virgin and Saint Anne with t
The quadratic equation y = –6x2 + 100x – 180 models the store’s daily profit, y, for selling soccer balls at x dollars. The quadratic equation y = –4x2 + 80x –
A child spends a lot of time putting objects into his mouth and touching everything in sight . This child is probably in which stage of development, according t
Please helpWhat is the measure of < AA) 37B) 42C) 55D) 138
_____ ratios compare current assets to current liabilities to indicate the speed with which a company can turn its assets into cash to meet debts as they fall d
Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
Find the constant of proportionality for the graph and write in the form y = kx. A) y = 1 5 x B) y = 3x C) y = 5x D) y = 15x
(4x+5y=0) (8x-15y=5) stimutanious equations
is chewing tobacco a healthier alternative to smoking? List reasons why or why not.​
Which of the following enzymes converts ATP to cAMP? Which of the following enzymes converts ATP to cAMP? Adenylyl cyclase Galactoside permease ATP synthase b-g