5927007969 5927007969

07-03-2021
Mathematics

contestada

50 points decreased by 26% is __________ points.

Respuesta :

reyreyfousy12 reyreyfousy12

07-03-2021

37% I believe.

Step-by-step explanation:

Answer Link

abdullahhucks abdullahhucks

17-03-2021

Answer:

37

Step-by-step explanation:

Answer Link

Otras preguntas

PLEASE HELP Which of these is the BEST example of a thesis statement? A. I'd like to tell you about a story I really enjoyed. It is “The Cask of Amontillado.

Did Britain have a choice to pass the quartering act? Why or why not?

What kind of mutation does this sentence represent: "THE FAT CAT CAT CAT ATE THE RAT"?

5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand

Why should anyone care about sustainable development as it relates to marine life in South America? A.Unsustainable fishing practices will deplete resources an

Are there italians?

Which phrase from Tim O'Brien's chapter "Good Form" best shows that his work is an example of metafiction? A. I want to tell you about why this book is writ

What are some internal and external reasons to someone might use, or decide not to use, vaping?

I don’t know how to solve this problem

Bart needs to borrow $7,000 from a local bank. He compares the monthly payments for a 9.75% loan for three different periods of timea. What is the monthly payme