mrnikita1310 mrnikita1310
  • 12-02-2021
  • Mathematics
contestada

Помогите пожалуйста срочно надо пожалкйста

Помогите пожалуйста срочно надо пожалкйста class=

Respuesta :

yyyuuuyyy yyyuuuyyy
  • 12-02-2021

Answer:

Me??? :(

Step-by-step explanation:

Answer Link

Otras preguntas

Which is the order of airflow during inhalation? nasal cavity, trachea, larynx, bronchi, bronchioles, alveoli nasal cavity, larynx, trachea, bronchi, bronchiole
Which of the following organisms is a prokaryote? amoeba influenza A virus charophyte algae E. coli
Which of the following is not a way that humans have increased the carrying capacity of the environment? agriculture using large amounts of natural resources do
WILL GIVE BRAINLIST FOR RIGHT ANSWER ​
Which polysaccharide is usually found in the cell wall of fungi? starch glycogen chitin cellulose
The nematode cuticle contains _____. glucose skin cells chitin nerve cells
When Earth’s Northern Hemisphere is tilted toward the Sun during June, some would argue that the cause of our seasons is that the Northern Hemisphere is physica
How do scientists interpret data?
The legal process by which a property owner challenges the real estate tax assessment on a given property in an attempt to reduce the property's assessment and
A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is