ashleygarcia090817 ashleygarcia090817

06-01-2021
Biology

contestada

write the code for RNA from this DNA STRAND :

AAAAAATTTTTTCCCGGGGTTTATATATC

Respuesta :

homadison4 homadison4

09-01-2021

Answer:

UUUUUUAAAAAAGGGCCCCAAAUAUAUAG

Explanation:

All you have to do is apply the same concept as DNA, but T (Thymine) is replaced with U (Uracil)

Answer Link

Otras preguntas

which is the world's longest river Mississippi Amazon Nile

provides a rich supply of iron and other minerals

Hey can someone correct me this part of my text please it a horror story btw thank you

Use I = PRT to solve. (time is in years) 1 = $312.50 R = 25% T = 0.25 years Find P. Please help :)) for 35 points !

Author's Position? Thesis statement/ Main Idea (What does the essay try to convey)

Melinda is starting a new job and is able to furnish her new office. She can choose one of three colors of paint, one of five kinds of furniture, one of three p

help please!!! thanks

Question 6 (1 point) Saved A wi-fi router in your house creates a ___ so that everyone in the house can share the internet connection. Extranet LAN WAN Intrane

Please help quick i have 10 minutes

A mature plant cell is different from a mature animal cell because the plant cell has?