redferanmi redferanmi

08-12-2020
Mathematics

contestada

If a bag of potatoes weighs 5.6 pounds how much does 0.7 bag of potatoes weigh

Respuesta :

Аноним Аноним

08-12-2020

Answer:

its 8

Step-by-step explanation:

Answer Link

madisonlthompson630 madisonlthompson630

08-12-2020

8 if you go through and workout the math :)

Answer Link

Otras preguntas

fill in the balnks Spanish

11. Give two to three examples of plants, animals and microbes that were exchanged between the old and new worlds and be able to explain which area they came fr

Choose the correct graph of the following condition.{(x, y): x - y = 6}

Use the information below to answer the following questions. Currency per U.S. $ Australia dollar 1.2377 6-months forward 1.2356 Japan Yen 100.3300 6-months for

Which of the following is the best source of scientific data? A. Magazine B. Scientific journal C. Newspaper D. Radio

PLEASE HELPPPPPPP!!!!!

if 12 men complete a piece of work in 10 days in how many days would 15 men complete the same work

A business issued a 90-day, 5% note for $10,000 to a creditor on account. The company uses a 360-day year for interest calculations. Journalize the entries to r

TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.

how do I modify objects in power point 2016 for an assignment