1236733 1236733
  • 06-12-2020
  • Mathematics
contestada

write a linear function f with f(6)=-2 and f(0)=-5

Respuesta :

hrobin4
hrobin4 hrobin4
  • 07-12-2020

Answer:

13

Step-by-step explanation:

-2(6)+(-5)(-5)

Answer Link

Otras preguntas

What is the complementary DNA strand for the following sequence: ATGGCTTGCCAAGGTCCGGAAACTTTG
In a cooking context, which of the following materials is the best heat conductor? A. Gas B. Glass C. Any dense liquid D. Iron
a map has a scale of 1 in. : 25 mi. Two cities are 175 mi apart. How far apart are they on the map?
2 + 1/3 what is the answer for the question
a transformation where a figure is turned around a fixed poing to create an image is called a A) reflection B) translation C) rotation D) none of the above
How many countries in world
Divide fractions 1/2 divided by 1/6
Which laws gave special consideration to immigrants who were members of underrepresented professions in the United States
The ____ clause limits the ability of the government to control or restrict religious practices.A. InstitutionalB. HolyC. Free ExerciseD. Establishment
All atoms are ______? A.) neutral, with the number of protons equaling the number of electrons, which is equal to the number of neutrons B.) positively charged