charlixoxo
charlixoxo charlixoxo
  • 14-11-2020
  • Mathematics
contestada

Find unit rate for 14 for 2.99

Respuesta :

h4388311
h4388311 h4388311
  • 14-11-2020

Answer: Okay so let's try to find the amount of money needed to buy 1 lb. Therefore, let's divide the fraction by 14.

Then we'll divide both the numerator and denominator by 14.

÷

Then we simplify and get:

14÷14=1     2.99÷14=.2135   We can round that to .21

The unit rate for each pound would be 1:.21

I don't know if that helped, but yeah. :)

Step-by-step explanation:

Answer Link

Otras preguntas

Label the male reproductive system. ​
What is 1/6 x 5 appreciate all answers!
1.(06.05 MC) Albiologist is comparing the growth of a population of flies per week to the number of flies a lizard will consume per week. She has devised an equ
Why is capillary action useful in nature? it allows water to climb the vessels in plants it allows water to cool down or heat up slowly it helps water dissolve
You are given the following DNA sequence and have determined that it is the sense parental strand. ATTGCCATGAAACGCCCCGGTACACCATTGTTCGGCAAATAAAAATAA Wha
(x+iy)^4 -(x+iy)^2 +16=0
Find the vertex of the graphed function. 16= \x - 4 +3 2 The vertex is at
What does it mean by “a family has been lying to themselves for basicallytheir entire lives”?
Which statements are true about the parallelograms? Select three options.
!!! no links !!! The bitterness and economic disaster left behind in parts of Europe by the Great Depression and Treaty of Versailles contributed to the rise of