cozuna0002 cozuna0002

14-05-2020
Mathematics

contestada

What is the answer to ... 7x-18=x

Respuesta :

wegnerkolmp2741o wegnerkolmp2741o

14-05-2020

Answer:

x=3

Step-by-step explanation:

7x-18=x

Subtract 7x from each side

7x -18-7x = x-7x

-18 = -6x

divide each side by -6

-18/-6 = -6x/-6

3 =x

Answer Link

Otras preguntas

A group of individuals of the same species living in the same area is called a(n) ________. family community population ecosystem

Condylomata are _____.

A store stocked 150 cans of popcorn for a win sale that weekend 72 cans sold what percent of the cans of popcorn stocked were sold that weekend

The inspiratory reserve volume measures the ________. amount of air remaining in the lung after a maximal exhalation amount of air that the lung holds amount of

The most common subcutaneous mycosis in temperate regions is ________.

The pectoral girdle supports the ________. arms legs skull thoracic cage

If a fixed asset with a book value of $10,000 is traded for a similar fixed asset, a trade-in allowance of $15,000 is granted by the seller and the transaction

A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is

complete the recursive formula of the arithmetic sequence 0, 11, 22, 33

Isabel has $465 , which is 10 times as much as Katie has . How much does Katie have ?