pacothebrat2435
pacothebrat2435 pacothebrat2435
  • 06-05-2020
  • Physics
contestada

A box contains about 5.54 1021 hydrogen
atoms at room temperature 21°C.
Find the thermal energy of these atoms.
Answer in units of J.

Respuesta :

nuuk nuuk
  • 12-05-2020

Answer:[tex]E=33.71\ J[/tex]

Explanation:

Given

No of atoms of hydrogen [tex]N=5.54\times 10^{21}[/tex]

Temperature of room [tex]T=21^{\circ}\approx 294\ K[/tex]

Thermal energy of the atoms is given by

[tex]E=\frac{3}{2}NkT[/tex]

where k=boltzmann constant

[tex]E=\frac{3}{2}\times 5.54\times 10^{21}\times 1.38\times 10^{-23}\times 294[/tex]

[tex]E=33.71\ J[/tex]

Hence the energy of the atoms is [tex]33.71\ J[/tex]

Answer Link

Otras preguntas

Find the x- and y-intercepts of the graph of the function f(x)=−4|x+5|+4.
Find the value of x3(2x-4)=18 ​
Evaluate the expression: 8w; when w = 4
Find the missing side of this right triangle. Х 8 16 x = = [?] Enter the number that belongs in the green box. Enter​
hey, another math question
¿Cuáles son los tramites para que una empresa se vuelva persona jurídica?
WILL GIVE BRAINLIEST What is the creation of a uniform, single culture called? Acculturation Homogenization Europeanization Envaluization
A student made a list of abiotic factors found in an ecosystem which biome is most likely represented in the list shown?​
Which algebraic expression is a polynomial with a degree of 2?
You are given the following DNA sequence and have determined that it is the sense parental strand. ATTGCCATGAAACGCCCCGGTACACCATTGTTCGGCAAATAAAAATAA Wha