ciaramoncayo2005 ciaramoncayo2005

08-01-2020
Mathematics

contestada

put the following equation in slope intercept form y - 4= - 1/4 (x - 2)

Respuesta :

jtulayan jtulayan

08-01-2020

1) y - 4 = -1/4x + 1/2 (distribute the -1/4)
2) y = -1/4x + 9/2 (bring over the -4)

Answer Link

Otras preguntas

combine like terms 1)15b+13c-12b+10c+8 2)15p+7q+5p-4q 3)19a+2b+11a-b

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3

Orville traveled at a speed that was twice as fast as randy, Orville traveled 240 miles in one hour less than it took randy to travel 150 miles. What were the s

Process by which a cell takes in a substance by surrounding it with the cell membrane; active transport

I need a thesis statement on the subject of Facebook social network

True or false: In Florida, the number of alcohol-related traffic deaths increased in 2008cpared to 2007

Padma is extremely confident and feels that lately she needs very little sleep. in addition, she reports that her thoughts seem to be going fast – similar to wa

If the discriminant is positive how many solutions are there

A 4-foot tall person standing with her back to the sun casts an 6-foot long shadow. To the nearest degree, what angle does the sun make with the ground?

i need help in this quick