garay310 garay310

06-03-2019
Mathematics

contestada

Misha used 1/4 of a carton of 12 eggs to make a omelet how many eggs did she use

Respuesta :

bnbbkpoole bnbbkpoole

06-03-2019

Answer: 3

Step-by-step explanation:

Multiply 1/4*12

Or divide 12 into 4 parts

Either way, you get 3

Answer Link

Otras preguntas

Ms. Luo is planning to buy a car valued at $20,000. The car depreciates by 17% each year. What is the value of the car after 4 years

After 14 trials, the average mass delivered from a pipet is 10 g with a standard deviation of 1 g. If you perform a 35th trial, What is the probability that the

Which of the following commands will help you identify the command that provides information about free memory? a) meminfo b) free -m c) top d) df -h

The coordinates of the point on the ellipse 16x² + 9y² = 400 where the ordinate decreases at the same rate at which the abscissa increase, are: A. ( 3 , 163 )B.

The fundamental frequency of a closed organ pipe is equal to the first overtone frequency of an open organ pipe. If the length of the open pipe is 60 cm, What w

Cual es la Variable de un terreno rectangular

A teacher (t) is located 18 feet from a library (L). The teacher notices a drone (d) flying at 40 degree angle of elevation from his line of sight . What is the

Of the DNA sequences below, which would probably be the harder to determine? a) CGATATATATATATACGATGGCATCACGAGCTGCATTCGCA b) CGATATATATATATACGATGGCATCACGAGCTGCA

Movie studios can earn more than double their U.S. and Canadian box-office receipts by distributing their films in foreign markets. a) True b) False

Which of the following changes to the external environment will most likely lead to an increase in the population of wolves? a. Decrease in prey availability b.