dakodayencho6107 dakodayencho6107
  • 10-11-2018
  • Biology
contestada

If a body cell of a chimpanzee contains 48 chromosomes, a gamete produced by a chimpanzee will contain how many chromosomes?

Respuesta :

salatulmaghrib
salatulmaghrib salatulmaghrib
  • 10-11-2018
The gamete will contain 24 chromosomes. (half the diploid number)
Answer Link

Otras preguntas

Why did European aristocrats push to make it harder to gain a noble title? a. to eliminate competition among the nobles fo
Anthony cut a piece of metal that weigh 2700 Dionne on cut a piece of metal that weighs 3200 g is how much heavy year was Dionne peace in kilograms
How could a person who shuffles be moving? A. slowly B. quickly C. vertically D. impatiently
Find the zeros of the function.[tex] h(x) = {x}^{2} + 29x + 100[/tex]
A presidential candidate receives his party’s nomination though ?
What was so revolutionary about the scientific revolution
Determine how the following bonds are made using Lewis dots structures
Who argued that the United States should address the potential threat posed by the Soviet Union with a strategy of "containment"?
5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
What chemical directly provides the energy needed for muscle contraction?