bmoreau1584 bmoreau1584
  • 10-04-2024
  • Biology
contestada

Use the genetic code to describe the sequence of amino acids that would be translated from the DNA sequence below. The strand below is the template strand. This DNA segment contains the beginning of the open reading frame.
5'AATGTGTTAAGACGTGCAGTACATT 3'
a. What is the mRNA sequence?
b. What is the sequence of amino acids translated?

Respuesta :

Otras preguntas

Complete the data set 4, 4, _, 4, 4, _, 4
The tuskegee syphilis study was ethically problematic because ________.
Which type of communication is usually handwritten?
triangle PQR hAS vertices P (4,-1),Q(-2,7), and R (9,9). find an equation of the median from R
Explain this cooment : "The fate of empires depends on the education of youth"
Which adjectives describe the young Madame Loisel?
Since bonds are generally considered among the safest investments, you would expect that they would _____.
Can someone please tell me the inequality to the question, Sam earned $450 during winter vacation. He needs to save $180 for a camping trip over spring break. H
tanx=0/a, I need to solve for a
Which form would best be classified as Postmodern?   A. A poem in the form of a questionnaire   B. An autobiography about a president   C. A short story that