austrichv austrichv

06-11-2022
Mathematics

contestada

Step 1 5x + 9 = 2x - 3
Step 2 3x + 9 = -3
Step 3 3x = -12
Step 4 x = -4
What operation did he perform to get from step 1 to step 2

Respuesta :

Otras preguntas

5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand

3x+4=-4×3x solve and show work please :)

An aquarium at a pet store has 18 Black Neon Tetra fish in it . A customer buys 12 Black neon Tetra Fish at the same time the store clerk adds 7 more Black neon

20 points! I need help (asap!!)

Kickboxing is a low intensity and low impact activity? TRUE OR FALSE

A costume designer has 40 yards of red fabric to make costumes for a musical in which 8 performers will wear red dresses and 14 people will wear red scarves. T

I’m having a hard time with these stupid problems someone please help I need all the steps -5=n+1, -6=x+2, y-9=-2, x-4=-10

what is the vertex of the following function? y=2|x-3|+1

7+7+6=?? Pls helps I am stuck

Identify the arrows that show input force